| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.070902 |
| Chromosome: | chromosome 6 |
| Location: | 6709682 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g295250 | (1 of 1) K07252 - dolichyldiphosphatase (E3.6.1.43) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCGTACTGCTGCTCCGTCTCGATACCCTAACCTACCTTCCGCCGTAAA |
| Internal bar code: | ATGAGCACCGCAATGCCTGTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1728 |
| LEAP-Seq percent confirming: | 93.3333 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCGTAGGTAGTGGTGGGCT |
| Suggested primer 2: | TCGCAAGCACTTCGTTACCT |