Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.070927 |
Chromosome: | chromosome 6 |
Location: | 6788933 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g296050 | FMO6 | (1 of 2) PF13738 - Pyridine nucleotide-disulphide oxidoreductase (Pyr_redox_3); Flavin-containing monooxygenase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGCTGGAGTAGTGTGAGTGATCCATCAGCTGGACTTCAACCCGTGAAG |
Internal bar code: | GGCGCAAAAGATCGTGGTAATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1647 |
LEAP-Seq percent confirming: | 50.0 |
LEAP-Seq n confirming: | 13 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTATGCGTGCAGGTCATTG |
Suggested primer 2: | AGCTCCTGTTGCATCGTGAA |