Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.070962 |
Chromosome: | chromosome 12 |
Location: | 6626829 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g539000 | ECT1 | (1 of 1) 2.7.7.14 - Ethanolamine-phosphate cytidylyltransferase / Phosphorylethanolamine transferase; CDP-Ethanolamine synthase | 3'UTR |
Cre12.g539050 | (1 of 1) IPR000363//IPR016159 - Alpha 1D adrenoceptor // Cullin repeat-like-containing domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACATACAGTGTCCGTAAATCCGTTTGTGTCGTCTAAACGGTACGGTACGC |
Internal bar code: | AAGGATGTGTTCGGTGTGGCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4033 |
LEAP-Seq percent confirming: | 89.011 |
LEAP-Seq n confirming: | 81 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 91 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCGTATGTGGCTATGGCGTC |
Suggested primer 2: | GAGCGATGACGACGATTTGC |