Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.070971 |
Chromosome: | chromosome 1 |
Location: | 7033206 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g050316 | (1 of 4) PTHR11229:SF5 - 50S RIBOSOMAL PROTEIN L3-1, CHLOROPLASTIC | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACAATGCCAGAGGCGGGGCGGGGACCTGGAGGCTGGGGCATGCAAGTG |
Internal bar code: | AGCTATTCTCTTGATAAGGTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2352 |
LEAP-Seq percent confirming: | 22.7273 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACAGCCACAGTACCACGATG |
Suggested primer 2: | GAGGAAAGTGGGGTAGTGGC |