| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.070982 |
| Chromosome: | chromosome 12 |
| Location: | 5432477 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g529550 | CALK1,CALK,ALK1 | Aurora-like kinase; (1 of 1) PF00069//PF07714//PF14531 - Protein kinase domain (Pkinase) // Protein tyrosine kinase (Pkinase_Tyr) // Kinase-like (Kinase-like) | 3'UTR |
| Cre12.g529600 | RPA1 | DNA-directed RNA polymerase I subunit 1; (1 of 1) K02999 - DNA-directed RNA polymerase I subunit RPA1 (RPA1, POLR1A) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATATCTGTCTAGCAGTATGAACTCGCTCCCACACAACAATCTTGGCAAAA |
| Internal bar code: | GCTGTGGGCAGGGGAGCGCGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4904 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 95 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 95 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTCATTGCCGACTTCATG |
| Suggested primer 2: | TGCGGGTATTGCAATGGACT |