Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.070982 |
Chromosome: | chromosome 12 |
Location: | 5432479 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g529550 | CALK1,CALK,ALK1 | Aurora-like kinase; (1 of 1) PF00069//PF07714//PF14531 - Protein kinase domain (Pkinase) // Protein tyrosine kinase (Pkinase_Tyr) // Kinase-like (Kinase-like) | 3'UTR |
Cre12.g529600 | RPA1 | DNA-directed RNA polymerase I subunit 1; (1 of 1) K02999 - DNA-directed RNA polymerase I subunit RPA1 (RPA1, POLR1A) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTCGTGCCCATTCAGGTGCTTGCAACAGCGCCCCTTATGCTGACGGCA |
Internal bar code: | CGCTCTCTAGTGGTTGCTGGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 5231 |
LEAP-Seq percent confirming: | 93.75 |
LEAP-Seq n confirming: | 30 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCGGGTATTGCAATGGACT |
Suggested primer 2: | CGCTCATTGCCGACTTCATG |