| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.070994 |
| Chromosome: | chromosome 17 |
| Location: | 2432193 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g714800 | ISG6,ISG-C3 | (1 of 5) PTHR16631:SF9 - GLUCAN 1,3-BETA-GLUCOSIDASE; Hydroxyproline-rich cell wall protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTTCGCCCTGATCCCTAACCATTCGTTGTTTGTAATCTTATACAGGCGC |
| Internal bar code: | CAAATATGAACTGCCGTGTGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 539 |
| LEAP-Seq percent confirming: | 89.4737 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCACTGACTTCGTCACGAA |
| Suggested primer 2: | ACCCAGCTAGATACAGCCCA |