| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.071002 |
| Chromosome: | chromosome 16 |
| Location: | 2108893 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g657750 | CCD2 | Carotenoid cleavage dioxygenase; (1 of 3) IPR005404 - Potassium channel, voltage dependent, Kv3.3 | 5'UTR |
| Cre16.g657800 | CCD3,CCD2 | (1 of 2) K00464 - all-trans-8'-apo-beta-carotenal 15,15'-oxygenase (diox1); Carotenoid cleavage dioxygenase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCATTCATCCTCTCGCCCGCCTCCTGGTTGATTTTTTCGGACCTGTGC |
| Internal bar code: | GTTTTAGGCTTTGCGTTTGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5840 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 68 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 68 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGGATGAGCTCGCGTTTG |
| Suggested primer 2: | CATCTGCTGCTCATTGCGAC |