| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.071052 |
| Chromosome: | chromosome 12 |
| Location: | 8516420 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g549400 | (1 of 4) PF09366 - Protein of unknown function (DUF1997) (DUF1997) | intron | |
| Cre12.g801481 | (1 of 1) IPR000104//IPR003072//IPR018971 - Antifreeze protein, type I // Orphan nuclear receptor, NOR1 type // Protein of unknown function DUF1997 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATCGCAGCGGCGGCTACTGCCGGCCCCAGCCCCGGCCCAAGCACCAGCG |
| Internal bar code: | TAAATTCCTATTTTCCCGTGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 189 |
| LEAP-Seq percent confirming: | 75.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCAATCCCGAACCACTCA |
| Suggested primer 2: | AGCCATCCTCGTCTGAGTCT |