| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.071084 |
| Chromosome: | chromosome 4 |
| Location: | 2787174 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g223850 | DEH1,HEL23 | (1 of 1) K12614 - ATP-dependent RNA helicase DDX6/DHH1 (DDX6, RCK, DHH1); Cytoplasmic DExD/H-box RNA helicase | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGTTTTTCGTTTACGTGTATGTACTTGATAGCTAGAAGGCCGAGTAAG |
| Internal bar code: | CTTTATGCTACGATGACTGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4855 |
| LEAP-Seq percent confirming: | 81.3333 |
| LEAP-Seq n confirming: | 61 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 75 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACAAGCCATCGTGCCCATT |
| Suggested primer 2: | ACTCTGCACAACACGAGAGG |