Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.071095 |
Chromosome: | chromosome 16 |
Location: | 5831985 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g679900 | XRN3 | 5' to 3' exoribonuclease; (1 of 1) K12619 - 5'-3' exoribonuclease 2 (XRN2, RAT1) | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGACGACTTCCCATTCTGGCGACCGCACGGGAGCCTCAGGTCTGGAAC |
Internal bar code: | CAAGTCGGTGGACTTTGGGTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2229 |
LEAP-Seq percent confirming: | 96.6102 |
LEAP-Seq n confirming: | 57 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 59 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGACCGAAACTCCACGACA |
Suggested primer 2: | GGTAACTTCTTCGCGGGGAT |