| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.071135 |
| Chromosome: | chromosome 5 |
| Location: | 393504 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g243600 | GOX2 | Glyoxal or galactose oxidase pseudogene; (1 of 1) IPR013783//IPR014756//IPR015202 - Immunoglobulin-like fold // Immunoglobulin E-set // Domain of unknown function DUF1929 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGATCACACCACCTACCGCGCCGTCCAGCATCTAGGTCCGAAGCCTACG |
| Internal bar code: | CTAGCGTACTTCCCGGTAATGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 70 |
| LEAP-Seq percent confirming: | 20.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCTGGAGATCCTGTCCAAC |
| Suggested primer 2: | GAATTACGCCAAGCCTGCTG |