Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.071185 |
Chromosome: | chromosome 9 |
Location: | 2604460 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g392300 | NAT22 | N-acetyltransferase; (1 of 3) IPR000182//IPR011011//IPR016181 - GNAT domain // Zinc finger, FYVE/PHD-type // Acyl-CoA N-acyltransferase | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGTCCCTGAGGTCCACGGGAAAGGGAGGCCAGTGTATATAACCGCAGGA |
Internal bar code: | TCACTGGCCAGAGCTATTTGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1908 |
LEAP-Seq percent confirming: | 22.2222 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCGTTACAATAGTTGGCCG |
Suggested primer 2: | CCTTTCCCACGCAACCAATG |