| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.071211 |
| Chromosome: | chromosome 12 |
| Location: | 8884879 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g546050 | DXR,DXR1 | (1 of 1) 1.1.1.267 - 1-deoxy-D-xylulose-5-phosphate reductoisomerase / DXP-reductoisomerase; 1-deoxy-D-xylulose 5-phosphate reductoisomerase, chloroplast precursor | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTGGATAGGCAGACCCCTCATCTCTACTCATCCTTCTGTGCGCCCTCC |
| Internal bar code: | TGGGTATGACGGGTGCCTTTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 444 |
| LEAP-Seq percent confirming: | 57.1429 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTCCCTCCCTCTTTCGAG |
| Suggested primer 2: | CCCTCATTAGGCCCGCTATG |