| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.071226 |
| Chromosome: | chromosome 1 |
| Location: | 8022226 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g058521 | LEW3,ALG11,GTR6 | Alpha-1%252C2-mannosyl transferase 11; (1 of 1) 2.4.1.131 - GDP-Man:Man(3)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGACTACCGTCGCGTGTGTCCACTCCGTTGTCAAGCATAGGCCACGCT |
| Internal bar code: | AGGTCGTTAAGAGGTTGTAGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 104 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATGTGCCTGGCTACAGCTT |
| Suggested primer 2: | GTAGCCAGGAACCCAGTCAC |