| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.071288 |
| Chromosome: | chromosome 9 |
| Location: | 5192090 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g801067 | (1 of 1) K00699 - glucuronosyltransferase (UGT) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGGAGGCTTAAGGCACTTCGTGCCAAGCTGTACAAATCATCATCACAA |
| Internal bar code: | GAATGAAGTCTCCCTATCTTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1727 |
| LEAP-Seq percent confirming: | 97.0588 |
| LEAP-Seq n confirming: | 66 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 68 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCCAAACGCTAGCAACTA |
| Suggested primer 2: | CCCTTGATCGCATGCATGTG |