Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.071326 |
Chromosome: | chromosome 16 |
Location: | 7019186 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g673729 | CPN11 | Chaperonin 11, chloroplastic; (1 of 1) PTHR10772:SF13 - CHLOROPLAST CHAPERONIN 10 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGTCCAACGAAACGCGGAAGCAAACTTGCTGCATCAACGATTTCCATG |
Internal bar code: | AGTATATCTAGTATCGTGATTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 689 |
LEAP-Seq percent confirming: | 7.52688 |
LEAP-Seq n confirming: | 14 |
LEAP-Seq n nonconfirming: | 172 |
LEAP-Seq n unique pos: | 186 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGCGAATTTCCAGCATGAT |
Suggested primer 2: | CGACCCAAACTAGGTGCTGT |