| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.071330 |
| Chromosome: | chromosome 1 |
| Location: | 222821 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g001350 | ABC1 | (1 of 3) 3.6.3.47 - Fatty-acyl-CoA-transporting ATPase; ABC transporter | 5'UTR |
| Cre01.g001400 | ZMP1 | (1 of 1) 3.4.24.36 - Leishmanolysin / Promastigote surface endopeptidase; Zinc-metallopeptidase-like protein | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCAAGCGCCCGCGATTGCGCGACCAGCTTCGTCTCTCGTAGACAGTTGC |
| Internal bar code: | GTGTGAAGGCGAGGGACTAGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2362 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 30 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTTTGGTTTAAGGCCAGC |
| Suggested primer 2: | GGGCAGGCAAAGAGGTATGT |