Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.071354 |
Chromosome: | chromosome 10 |
Location: | 6609112 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g465850 | (1 of 1) K12572 - PAB-dependent poly(A)-specific ribonuclease subunit 3 (PAN3) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCGCTGCTCGGTCGGTGCTGGAACGGAAATGCGCGTTACTGTAACAGC |
Internal bar code: | TGAACCCGGATTACGGATACCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3578 |
LEAP-Seq percent confirming: | 98.0 |
LEAP-Seq n confirming: | 98 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 100 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAAAGAGGAAGGCACGGGAA |
Suggested primer 2: | GGCTGTTGACAACTGTGCTG |