| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.071369 |
| Chromosome: | chromosome 15 |
| Location: | 201287 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g634701 | DIV20,RECQ4 | (1 of 1) K10730 - ATP-dependent DNA helicase Q4 [EC:3.6.4.12] (RECQL4); RecQ-class helicase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACTCATATGATTGCTGGAGCCAGGAAGATTATAGCTAGTCTGCCGAATG |
| Internal bar code: | CATGATAGGATCAAAGAATGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1493 |
| LEAP-Seq percent confirming: | 87.5 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGTACCGCCTTGGCTCTCT |
| Suggested primer 2: | GTGATGCATGCACGCAGTAG |