Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.071369 |
Chromosome: | chromosome 15 |
Location: | 201287 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre15.g634701 | DIV20,RECQ4 | (1 of 1) K10730 - ATP-dependent DNA helicase Q4 [EC:3.6.4.12] (RECQL4); RecQ-class helicase | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACTCATATGATTGCTGGAGCCAGGAAGATTATAGCTAGTCTGCCGAATG |
Internal bar code: | CATGATAGGATCAAAGAATGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1493 |
LEAP-Seq percent confirming: | 87.5 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAGTACCGCCTTGGCTCTCT |
Suggested primer 2: | GTGATGCATGCACGCAGTAG |