| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.071414 |
| Chromosome: | chromosome 6 |
| Location: | 2619197 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g270050 | (1 of 587) 2.7.11.1 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase | 3'UTR | |
| Cre06.g270100 | SBE2a,SBE2 | (1 of 3) 2.4.1.18 - 1,4-alpha-glucan branching enzyme / Glycogen branching enzyme; Starch Branching Enzyme 2 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCGAACTTCGAAGAAAGTGGCCGTGGCCAGGGGTCAGGAATAATTTGT |
| Internal bar code: | CATATAGAGGTCACCTTGACCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1469 |
| LEAP-Seq percent confirming: | 92.1053 |
| LEAP-Seq n confirming: | 35 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCAAGTAAATCCCCGGGCA |
| Suggested primer 2: | AGCCCTAATCGTGGTGGTTG |