| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.071427 |
| Chromosome: | chromosome 5 |
| Location: | 3024733 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g231000 | CSA5 | Chlorophyceae-specific gene family A protein | 3'UTR |
| Cre05.g800571 | (1 of 1) IPR007730 - Sporulation-related domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACAGGCTACTGAACTGTTGCAGGCGGCACGCCCCTGGGGTCCAGAGCA |
| Internal bar code: | CGTATATCGAAGTGCGAACACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2776 |
| LEAP-Seq percent confirming: | 57.1429 |
| LEAP-Seq n confirming: | 28 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCAGTATGTCAGGCAGGT |
| Suggested primer 2: | CAATGTCATTACTGGCGGCG |