| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.071448 |
| Chromosome: | chromosome 7 |
| Location: | 4764530 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g345750 | NAT20 | N-acetyltransferase; (1 of 3) IPR000182//IPR011011//IPR016181 - GNAT domain // Zinc finger, FYVE/PHD-type // Acyl-CoA N-acyltransferase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGTGTCTTCTACCATGAGATATGATTTGTGCGAGTTGCTTGTTACAAAG |
| Internal bar code: | CCTTATTAAGAAGTTCGTCTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1398 |
| LEAP-Seq percent confirming: | 30.4348 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAAGCGTCTTTTTCCCAGC |
| Suggested primer 2: | GTACGTCCACACCACCCATT |