| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.071468 |
| Chromosome: | chromosome 6 |
| Location: | 7947779 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g304300 | POA6 | 20S proteasome alpha subunit F; (1 of 1) K02725 - 20S proteasome subunit alpha 6 (PSMA1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTCAGACGATCTCACCAGCCGCACCTGCGCCTCGTCTGTGGCGCCATG |
| Internal bar code: | ACGAATGGAATATGCTACGTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 791 |
| LEAP-Seq percent confirming: | 86.6667 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAACCAACGACAACGAGCG |
| Suggested primer 2: | GATGCGATGGAATAGGGGCA |