| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.071484 |
| Chromosome: | chromosome 3 |
| Location: | 2547132 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g159750 | VPS36 | Subunit of ESCRT-II complex; (1 of 1) K12190 - ESCRT-II complex subunit VPS36 (VPS36, EAP45) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACCGGTTTATCAAAGATGGTGCAACACTGCAACACCTCTGTCGTTCGG |
| Internal bar code: | CCGACACGCCGGTCGTATACTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4572 |
| LEAP-Seq percent confirming: | 93.75 |
| LEAP-Seq n confirming: | 105 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 112 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTATGTGGGCAGGCTTTCA |
| Suggested primer 2: | AACTTCTTCAGGCAGGACGG |