| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.071541 |
| Chromosome: | chromosome 16 |
| Location: | 1034779 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g649150 | (1 of 1) PF13414//PF13920 - TPR repeat (TPR_11) // Zinc finger, C3HC4 type (RING finger) (zf-C3HC4_3) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGCGCTATATGCACTGTTATTCGTCTATGTGGGCGGAAACCAGCGGCT |
| Internal bar code: | AAACGGTAGAATAGTGAACCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1126 |
| LEAP-Seq percent confirming: | 53.125 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAACTTGTAAGCGGCGTCA |
| Suggested primer 2: | AGGCATTCCACTGGTAAGCC |