| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.071548 |
| Chromosome: | chromosome 16 |
| Location: | 2437241 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g660024 | (1 of 1) IPR026555 - KAT8 regulatory NSL complex subunit 3/Testis-expressed sequence 30 protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCATTATCGCGCGCGCACACAACTGAACATGTACACGTGCTCCCCCTCT |
| Internal bar code: | GAGTTGGCACTACCCTCTTCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1911 |
| LEAP-Seq percent confirming: | 45.283 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTATTGGGGGAGCTAGACGC |
| Suggested primer 2: | CCAGCCTGTACCATGCAGAA |