| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.071555 |
| Chromosome: | chromosome 10 |
| Location: | 5756183 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g459900 | PFH4,PHX16,P4H4 | Prolyl 4-hydroxylase 4; (1 of 5) PTHR10869//PTHR10869:SF55 - PROLYL 4-HYDROXYLASE ALPHA SUBUNIT // OXOGLUTARATE/IRON-DEPENDENT OXYGENASE | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGTGGAATCCAACGCGCGCACGCCTCTCCCCCTTTGGGACGGTATCTA |
| Internal bar code: | TCATCGGTAGTGGAGACCCCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 192 |
| LEAP-Seq percent confirming: | 69.2308 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACACACACGCTCACCAGAC |
| Suggested primer 2: | CCATTTCCCAACCCCCTCTC |