Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.071565 |
Chromosome: | chromosome 3 |
Location: | 403072 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g144827 | MIA40 | Mitochondrial intermembrane space protein 40; (1 of 1) IPR012891//IPR015360 - GCK // XPC-binding domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGAACCCACTAGTGCCCGGCCCATCCTCCTCCTCTTCCCTAGACCCCC |
Internal bar code: | AAGGGACAAGGTCCGGGTTTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1602 |
LEAP-Seq percent confirming: | 88.2353 |
LEAP-Seq n confirming: | 15 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTCCAGGCATTCATGGACT |
Suggested primer 2: | TGGCTTGTCGTGAGAGAACC |