Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.071579 |
Chromosome: | chromosome 6 |
Location: | 1456396 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g260200 | MITC18,MCP18 | (1 of 1) K15100 - solute carrier family 25 (mitochondrial citrate transporter), member 1 (SLC25A1, CTP); Mitochondrial substrate carrier protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGACGCGTGTGGCGCTGGCCCATTGCGAAGGCGGCCATTGGGCACTGTA |
Internal bar code: | GGTGGTTCAGTAACTTCATCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3359 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 97 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 97 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCATTTGGCCGGTAGACCTT |
Suggested primer 2: | CAGCTGCAGTGAGAAGGTGA |