Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.071664 |
Chromosome: | chromosome 17 |
Location: | 2288660 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g802049 | (1 of 352) PF00078 - Reverse transcriptase (RNA-dependent DNA polymerase) (RVT_1) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAATGCAAAGCTTGGCGAAAAAGAAATGGAGTGGTAGTTGTGCTAATT |
Internal bar code: | GCGTAGGCAATACGGTCGGCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3084 |
LEAP-Seq percent confirming: | 15.2542 |
LEAP-Seq n confirming: | 18 |
LEAP-Seq n nonconfirming: | 100 |
LEAP-Seq n unique pos: | 118 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACGTCGCAAAGTGTGAACG |
Suggested primer 2: | TACAAGGTGGTGAGCACGAC |