| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.071670 |
| Chromosome: | chromosome 1 |
| Location: | 3992590 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g026200 | PPR9 | PentatricoPeptide Repeat protein 9; (1 of 6) PF01535 - PPR repeat (PPR) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGCCGATGACTTGCGATCAGAGGTGGCTGAGCACCGTTCGCTTGACTGC |
| Internal bar code: | ATGCACGTCAAGAATCTCTAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1330 |
| LEAP-Seq percent confirming: | 97.8261 |
| LEAP-Seq n confirming: | 45 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGGATGTACTGTACCGACG |
| Suggested primer 2: | GACTCTGCAGCTTGGGATGT |