| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.071676 |
| Chromosome: | chromosome 10 |
| Location: | 465377 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g420900 | HEL44 | (1 of 1) K13181 - ATP-dependent RNA helicase DDX27 [EC:3.6.4.13] (DDX27, DRS1); DEAD/DEAH box helicase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGCCACCTCACCGCTCACCTGTGCAGCTCACCCCGGTCCCCGTAGCCT |
| Internal bar code: | CACGGGAGCGTATAAGCTCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 988 |
| LEAP-Seq percent confirming: | 52.381 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGTCCTTACAAGTCCCGGC |
| Suggested primer 2: | AACGTAGGAATGCCCGTTGT |