| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.071701 |
| Chromosome: | plastome |
| Location: | 86548 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802299 | rps2,ChreCp034,2717005 | 30S ribosomal protein S2; (1 of 1) PTHR12534:SF0 - 28S RIBOSOMAL PROTEIN S2, MITOCHONDRIAL | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGATTCTATTTATGATAAAAAATTAAGTAGACAATCTAAAAAAGTAGC |
| Internal bar code: | TCGATGTATACGGAAGCTTGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 96 |
| LEAP-Seq percent confirming: | 12.5 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCTTCGGGCAAGTAAACT |
| Suggested primer 2: | TCAACGTCTGGTAAGCAAGCA |