| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.071718 |
| Chromosome: | chromosome 14 |
| Location: | 3565122 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g630859 | HID1 | 3-hydroxyisobutyrate dehydrogenase; (1 of 1) 1.1.1.31 - 3-hydroxyisobutyrate dehydrogenase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTACGCCTCCAGTCATATCGCCTATACCTTTGGTAAAAATACATCTTGTT |
| Internal bar code: | CCAATGATAAGGCATCGGTAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1322 |
| LEAP-Seq percent confirming: | 95.3125 |
| LEAP-Seq n confirming: | 61 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 64 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGCCGTGACTTGCAATTC |
| Suggested primer 2: | TCGGAAGGCAGGCGTTTTAT |