| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.071729 |
| Chromosome: | chromosome 6 |
| Location: | 5730036 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g288400 | uS11m,MRPS11 | (1 of 3) PF00411 - Ribosomal protein S11 (Ribosomal_S11); Mitochondrial ribosomal protein S11 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCATGTGATTCGCCGCATCAACTCATCGCTTCGCCCCATCCACGCATCAC |
| Internal bar code: | GGGTGGAGTAGTGAAACCCCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1892 |
| LEAP-Seq percent confirming: | 98.1481 |
| LEAP-Seq n confirming: | 53 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 54 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGCTAGGCTACTCGTCGG |
| Suggested primer 2: | TTGATAGCTCGATTCGGCCC |