| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.071744 |
| Chromosome: | chromosome 16 |
| Location: | 4435201 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g668150 | (1 of 31) IPR003590 - Leucine-rich repeat, ribonuclease inhibitor subtype | 3'UTR | |
| Cre16.g668200 | ING? | (1 of 1) PF00628//PF12998 - PHD-finger (PHD) // Inhibitor of growth proteins N-terminal histone-binding (ING); PHD-type zinc-finger protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCTCTGGCCCTATCATGACGTTATGTATGGCTAACAGGGGGATCATGGC |
| Internal bar code: | ATGATCTTGACAGTGTATGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3827 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 88 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 88 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGGTCATCCTTGTGTGTGA |
| Suggested primer 2: | GGTCAAGTCGGGCAAGAAGA |