| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.071747 |
| Chromosome: | chromosome 1 |
| Location: | 1485282 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g007950 | CYP2,CYP55B1 | (1 of 1) 1.7.1.14 - Nitric oxide reductase (NAD(P)(+), nitrous oxide-forming) / NOR; Cytochrome P450, CYP55 superfamily, CYP55A family | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGAAACACCCATGCACGTGTACCAATAAGTTCTGCATGCTCCTTCCCG |
| Internal bar code: | TTCGAGTTACGTCGTCACCTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 672 |
| LEAP-Seq percent confirming: | 16.129 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 52 |
| LEAP-Seq n unique pos: | 62 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTTCTTCACCAGCTGCGTA |
| Suggested primer 2: | TAGTGGCTGTGCGTGTAAGG |