| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.071764 |
| Chromosome: | chromosome 17 |
| Location: | 3510485 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g724350 | POA5 | 20S proteasome alpha subunit E; (1 of 1) K02729 - 20S proteasome subunit alpha 5 (PSMA5) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTGGTCAGGCCCTGCTGGTGCACAGGCTTCAACACGGGGAGGCCCGCA |
| Internal bar code: | TAAACATGTTGGCTGTAATTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3030 |
| LEAP-Seq percent confirming: | 96.7742 |
| LEAP-Seq n confirming: | 30 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAACGAGGCCATCTGCTGA |
| Suggested primer 2: | CTCAAACTGCTTGTGCGCTT |