| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.071793 |
| Chromosome: | chromosome 4 |
| Location: | 2821433 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g224150 | (1 of 1) 2.7.1.30 - Glycerol kinase / Glycerokinase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTAAATCTACTGCTGGCTCAGCTTCGGGGACGTCCAACTCCAGCCCTA |
| Internal bar code: | TACCAACGAGATAAATGGGCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1260 |
| LEAP-Seq percent confirming: | 46.2963 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 54 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTCAAGTGGGTCGTGTTCG |
| Suggested primer 2: | CCTCCCGCCACCCTTTAATT |