| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.071799 |
| Chromosome: | chromosome 13 |
| Location: | 3117994 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g584700 | (1 of 2) PF02636 - Putative S-adenosyl-L-methionine-dependent methyltransferase (Methyltransf_28) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCCAGGATGAAGTCCAGCACCCTGTTGAAGCGCTCGTCCAGCTGCTGC |
| Internal bar code: | CAGGCAAGTTGGGCGCAATAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 550 |
| LEAP-Seq percent confirming: | 30.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGATGGAGGTGCTGGACAAC |
| Suggested primer 2: | GTGAAGTCGTAGGTGGGGTG |