Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.071836 |
Chromosome: | chromosome 14 |
Location: | 3108812 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g628350 | CLPQ,HSLV1 | ATP-dependent subunit of mitochondrial HslUV protease; (1 of 1) K01419 - ATP-dependent HslUV protease, peptidase subunit HslV [EC:3.4.25.2] (hslV, clpQ) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGACTGAGCCATCTCCAAGCAGAGGATGCTTGCTGGACTGGCAGCGCTG |
Internal bar code: | AGTTTTACATTTCAAAGTAACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1443 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 21 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAATGACGGGGCCCAGTAAA |
Suggested primer 2: | GTCGTGACCAGCTTCCTCAA |