| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.071841 |
| Chromosome: | chromosome 13 |
| Location: | 2699845 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g581650 | PRPL7,L12 | (1 of 1) PF00542//PF16320 - Ribosomal protein L7/L12 C-terminal domain (Ribosomal_L12) // Ribosomal protein L7/L12 dimerisation domain (Ribosomal_L12_N); Chloroplast ribosomal protein L7/L12 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTCGCAGTGACGCACACGCCCCTAACCACCCCACAGCGGCGACCCGGC |
| Internal bar code: | GATCTGTATCGTCAGTGTGATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 437 |
| LEAP-Seq percent confirming: | 7.69231 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTACAAGGTGGTCCGCAAC |
| Suggested primer 2: | TACCGTAATCGCATCAGGGC |