| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.071895 |
| Chromosome: | plastome |
| Location: | 168150 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802324 | tic214,orf1995,ycf1,2717035,ChreCp059 | Forms with TIC20, TIC56 and TIC100 the 1-MD complex mediating chlorolast protein import | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGCAAAGTTGTTGATTGTTGCGACTTTGGGCAACCACAACTGCTTAGC |
| Internal bar code: | GCTCAGGCTTGCTTTGTCTGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2655 |
| LEAP-Seq percent confirming: | 42.1053 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCTCCTTCGATGCCTCTGG |
| Suggested primer 2: | GGTACCGCTACTAACTCGCC |