| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.071904 |
| Chromosome: | chromosome 8 |
| Location: | 3281818 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g800942 | (1 of 1) IPR000953//IPR012337//IPR016197//IPR023780 - Chromo/chromo shadow domain // Ribonuclease H-like domain // Chromo domain-like // Chromo domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGTCGAGTTTGACTGCGACAGGTCCAATTGTTTGAGTGACCGTATAGG |
| Internal bar code: | GGGGTGTCGTAGCAGTGAGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2969 |
| LEAP-Seq percent confirming: | 32.0388 |
| LEAP-Seq n confirming: | 33 |
| LEAP-Seq n nonconfirming: | 70 |
| LEAP-Seq n unique pos: | 103 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCGTGGTATTCGTCGACCG |
| Suggested primer 2: | GCAATGGACGAACGCCATAC |