| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.071911 |
| Chromosome: | chromosome 1 |
| Location: | 2967767 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g018650 | (1 of 1) PF01342//PF13771 - SAND domain (SAND) // PHD-like zinc-binding domain (zf-HC5HC2H) | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAAAGTATCCTGGGTGCCAGCTCCCCGCCGGCGGGGCAGCGCTGCTGCG |
| Internal bar code: | GTTGAGGTGCTTCTAAGGTTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 790 |
| LEAP-Seq percent confirming: | 62.5 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATGGCAGTGAACCGTTTGC |
| Suggested primer 2: | TGTGTGTCACGCTACGACAA |