| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.071949 |
| Chromosome: | chromosome 7 |
| Location: | 3647330 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g337300 | DSK2,DYRK2,DYRKP1,DYRKP,STD1 | Dual-Specificity Tyrosine-Regulated Protein Kinase involved in starch degradation; (1 of 2) PTHR24058//PTHR24058:SF23 - DUAL SPECIFICITY PROTEIN KINASE // SERINE/THREONINE KINASE-RELATED | 5'UTR |
| Cre07.g337350 | GT90F8,GT90-8 | GT90 family protein 8; (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGCATCGATTTTTCTGCCAGATCAAGTAGTATTCAATAACCACAGGTA |
| Internal bar code: | ATGAAGTCGGGACTCTTTTTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2381 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTGAGTTGACAAGCGCAC |
| Suggested primer 2: | CCTCACTCTTGCTCACACGT |