Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.072078 |
Chromosome: | chromosome 9 |
Location: | 4189691 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g399738 | (1 of 239) IPR016024 - Armadillo-type fold | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGCAGCGCCGTGTCCGGTGCCGCCAGCTTGGCCAGCGCCAGCAGCCCC |
Internal bar code: | CCAACGCGCTGGTCGCGGTAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 458 |
LEAP-Seq percent confirming: | 15.3846 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGTCCAAAGACCGCCAGTA |
Suggested primer 2: | ACCCTTCCCCTTTCCCTCTT |