Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.072085 |
Chromosome: | chromosome 3 |
Location: | 6057407 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g190100 | EIF3B | (1 of 1) K03253 - translation initiation factor 3 subunit B (EIF3B); Eukaryotic translation initiation factor 3, subunit B | 5'UTR |
Cre03.g800353 | (1 of 1) K06631 - polo-like kinase 1 (PLK1) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGCGACTTCTGCTCGGAGGCGACCTCGAGCATCGTGCCCATTCCCCG |
Internal bar code: | ACGGAACGGTGGAATTCTCGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2976 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 47 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GATCCGCACGTTTCACATCG |
Suggested primer 2: | GAGTATCCACAGCGAGGCTC |