| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.072112 |
| Chromosome: | chromosome 9 |
| Location: | 2340255 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g394200 | FAS9,FLA4,FAP102 | Flagellar Associated Protein 102; (1 of 21) PF02469 - Fasciclin domain (Fasciclin) | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCAGCCCATCTTCCAGATGTACAAAGCTGACACCCCTCCCTTGTCCGGG |
| Internal bar code: | CCACTAGGAGCATGCCTATGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1919 |
| LEAP-Seq percent confirming: | 73.6842 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCATCACCACACCATACCA |
| Suggested primer 2: | CTTCCTGTCCAAGCTCCAGG |